View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21165_low_77 (Length: 207)
Name: NF21165_low_77
Description: NF21165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21165_low_77 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 38196132 - 38196338
Alignment:
| Q |
1 |
agctgaacagaaaaccgaacttccttcatatctccttcccacaccttatcattcctccgacgccataaacaccacaacatcatggcgatatcagtacata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196132 |
agctgaacagaaaaccgaacttccttcatatctccttcccacaccttatcattcctccgacgccataaacaccacaacatcatggcgatatcagtacata |
38196231 |
T |
 |
| Q |
101 |
gttgtgacggtaatctgcataataaactnnnnnnncattaagcaaaattcgaaactgtagcagcagcttcagaaatagtttcccataacccagcaacttg |
200 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196232 |
gttgtgttggtaatctgcataataaactaaaaaaacattaagcaaaattcgaaactgtagcagcagcttcagaaatagtttcccataacccagcaacttg |
38196331 |
T |
 |
| Q |
201 |
cccaact |
207 |
Q |
| |
|
|| |||| |
|
|
| T |
38196332 |
ccaaact |
38196338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 6508581 - 6508654
Alignment:
| Q |
19 |
acttccttcatatctccttcccacaccttatcattcctccgacgccataaacaccacaacatcatggcgatatc |
92 |
Q |
| |
|
||||| |||||||| |||||| |||| |||| |||||| | ||||||||||||||| |||||||| |||||||| |
|
|
| T |
6508581 |
acttctttcatatcaccttcctacactttattattccttctacgccataaacaccataacatcatcgcgatatc |
6508654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University