View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21166_low_18 (Length: 237)
Name: NF21166_low_18
Description: NF21166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21166_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 38321165 - 38321373
Alignment:
| Q |
13 |
aagaacaagaaagatgcaatagtgaggcaattaagaaaagatttggttgagctaatacaaggtggttatgaagaagctgctctaaatcgggtaatttgtt |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38321165 |
aagaacaagaaagatgcaatagttaggcaattaagaaaagatttggttgagctaatacaaggtggttatgaagaagctgctctaaaccgggtaatttgtt |
38321264 |
T |
 |
| Q |
113 |
aataataacattaacctagtaataatattactannnnnnnnatttgttgtaacttgaaagtaatctcattcttttattttgctttcatagtatatcatgt |
212 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38321265 |
aataataacatt-tcatagtaataatattacta-tttttttatttgttgtaacttgaaagtaatctcattcttttattttgctttcatagtatatcatgt |
38321362 |
T |
 |
| Q |
213 |
atgttctttct |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
38321363 |
atgttctttct |
38321373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University