View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21166_low_9 (Length: 297)
Name: NF21166_low_9
Description: NF21166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21166_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 285
Target Start/End: Original strand, 30770114 - 30770380
Alignment:
| Q |
16 |
tcaacaactcagggattctctcaagaggtgtgtcagattctgcaggagattcttttgtgaatcttgataatgttcctgctagtggtgattcaagcaataa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
30770114 |
tcaacaactcagggattctctcaagaggtgtgtcagattcagcaggagattcttttgtgaatcttgatagtgttcctgctagtg---attcaagcaataa |
30770210 |
T |
|
| Q |
116 |
cttagaatctcaagtagaatcactgactctgcttgaaaacaacaacaataaggttaagaatgtttttgataatgttaatgctgtgaattcaacacctaat |
215 |
Q |
| |
|
||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30770211 |
cttggaatctcaagtagaatcattgactctgcttgaaaacaacaacaataaggttaagaatgttcttgataatgttaatgttgtgaattcaacacctaat |
30770310 |
T |
|
| Q |
216 |
tcacctatgctagaaaatagtctatcatcttcatctttgactccttcaatggagaatttgccaccaattc |
285 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30770311 |
tcacctatgctagaaaacagtttatcatcatcatctttgactccttcaatggagaatttgccaccaattc |
30770380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University