View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21167_low_13 (Length: 350)
Name: NF21167_low_13
Description: NF21167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21167_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 176 - 338
Target Start/End: Original strand, 8245448 - 8245611
Alignment:
| Q |
176 |
ctttgaaccaatatatcagattgatagctgattttcatatttttcagcacacaggctcacaagatcttaggtattgcataaaagaatagaagtgaaattg |
275 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||| |||| | | |||||||||||||||||||||||||| |||||| ||||||| |||||| |
|
|
| T |
8245448 |
ctttgaaagaatttatcagattgatagctgattttcatatttctcagaatataggctcacaagatcttaggtattgcaaaaaagagtagaagtaaaattg |
8245547 |
T |
|
| Q |
276 |
aatctcaatatttcacgctactccaatc-tttacgatatcatattaattattcataaatatttc |
338 |
Q |
| |
|
||| |||||| |||| |||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
8245548 |
aatatcaatagttcaagctactccaatcttttaggatatcatattaattattcataaatatttc |
8245611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 111 - 156
Target Start/End: Original strand, 8245363 - 8245408
Alignment:
| Q |
111 |
gaatgaatttctatctagagaaaattaaatgtctgttgtctgcata |
156 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
8245363 |
gaatgaatttctatctagagaaaggtaaatgtttgttgtctacata |
8245408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 238 - 340
Target Start/End: Original strand, 12834212 - 12834312
Alignment:
| Q |
238 |
gatcttaggtattgcataaaagaatagaagtgaaattgaatctcaatatttcacgctactccaatctttacgatatcatattaattattcataaatattt |
337 |
Q |
| |
|
||||||||| |||||||| |||||| |||||||||||||||||||||| |||| ||| || ||||||||| | ||||||||||||||| ||| |||||| |
|
|
| T |
12834212 |
gatcttaggcattgcatacaagaatcgaagtgaaattgaatctcaatagttcaagctgcttcaatctttagg--atcatattaattatttatatatattt |
12834309 |
T |
|
| Q |
338 |
cgt |
340 |
Q |
| |
|
||| |
|
|
| T |
12834310 |
cgt |
12834312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University