View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21167_low_22 (Length: 239)
Name: NF21167_low_22
Description: NF21167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21167_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10124892 - 10124670
Alignment:
| Q |
1 |
gaattcactaacctgcatgagaaagccgtcttgcttcagattctgcgcgctggtagaaacccttttggtcaccgcgaacatattggctgagaaaatcctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10124892 |
gaattcactaacctgcatgagaaagccgtcttgcttcagattctgcgcgctggtagaaacccttttggtcaccgcgaacatattggctgagaaaatcctt |
10124793 |
T |
 |
| Q |
101 |
cagaaatcttgctagcttttcttcccttcctttttggacttcctattttgaagcaaaccataatgtaaacatcgagtttaatatcatgagaaacgtataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10124792 |
cagaaatcttgctagcttttcttcccttcctttttggacttcctattttgaagcaaaccataatgtaaacatcgagtttaatatcatgagaaacgtataa |
10124693 |
T |
 |
| Q |
201 |
aatgaactttgaaaatacaaata |
223 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
10124692 |
aatgaaccttgaaaatacaaata |
10124670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 10118218 - 10118086
Alignment:
| Q |
1 |
gaattcactaacctgcatgagaaagccgtcttgcttcagattctgcgcgctggtagaaacccttttggtcaccgcgaacatattggctgagaaaatcctt |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||| || |
|
|
| T |
10118218 |
gaattcactaacctgcatgagagagccgtcttgcttcagattttgcgcgctggtagaaacccctttggtcaccacgaacatattggctgagaaaatcttt |
10118119 |
T |
 |
| Q |
101 |
cagaaatcttgctagcttttcttcccttccttt |
133 |
Q |
| |
|
|| |||||||||||||||||||||||| |||| |
|
|
| T |
10118118 |
caagaatcttgctagcttttcttccctttcttt |
10118086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University