View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21167_low_25 (Length: 226)
Name: NF21167_low_25
Description: NF21167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21167_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 156
Target Start/End: Original strand, 8245363 - 8245408
Alignment:
| Q |
111 |
gaatgaatttctatctagagaaaattaaatgtctgttgtctgcata |
156 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
8245363 |
gaatgaatttctatctagagaaaggtaaatgtttgttgtctacata |
8245408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 8245448 - 8245488
Alignment:
| Q |
176 |
ctttgaaccaatatatcagattgatagctgattttcatatt |
216 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
8245448 |
ctttgaaagaatttatcagattgatagctgattttcatatt |
8245488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University