View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21167_low_25 (Length: 226)

Name: NF21167_low_25
Description: NF21167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21167_low_25
NF21167_low_25
[»] chr3 (2 HSPs)
chr3 (111-156)||(8245363-8245408)
chr3 (176-216)||(8245448-8245488)


Alignment Details
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 156
Target Start/End: Original strand, 8245363 - 8245408
Alignment:
111 gaatgaatttctatctagagaaaattaaatgtctgttgtctgcata 156  Q
    |||||||||||||||||||||||  ||||||| |||||||| ||||    
8245363 gaatgaatttctatctagagaaaggtaaatgtttgttgtctacata 8245408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 8245448 - 8245488
Alignment:
176 ctttgaaccaatatatcagattgatagctgattttcatatt 216  Q
    |||||||  ||| ||||||||||||||||||||||||||||    
8245448 ctttgaaagaatttatcagattgatagctgattttcatatt 8245488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University