View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21167_low_28 (Length: 204)
Name: NF21167_low_28
Description: NF21167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21167_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 33310544 - 33310639
Alignment:
| Q |
1 |
ggttattgtggttattctcttttagctaagttaaactaatttacgattgaatacaaccgacataacaaaagttttgtcaagagatttttgctacaa |
96 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
33310544 |
ggttattgtggttattttgctttagctaagttaaactagtttacgattggatacaaccgacataacaaaagttttgccaagagacttttgctacaa |
33310639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 33310694 - 33310734
Alignment:
| Q |
149 |
attgttcatcattgctgaacttcaataatctttatcttcat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33310694 |
attgttcatcattgctgaacttcaataatctttatcttcat |
33310734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University