View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21168_low_12 (Length: 290)
Name: NF21168_low_12
Description: NF21168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21168_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 3 - 272
Target Start/End: Complemental strand, 37790280 - 37790005
Alignment:
| Q |
3 |
ataccaagactttcaactggtgaccaactaagtcaaactcggatactcagagtgcaaccgacaaaactcagtgtctacgatggtggtggtggatcagagg |
102 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37790280 |
ataccaagactttcaatcggtgaccaactgagtcaaactcggatactcagagtgcaaccgacaaaactcagtgtctacgatggtggtggtggatcagagg |
37790181 |
T |
|
| Q |
103 |
tttcgttatggaactcagtcttcgacggagtaatgataagagatgtttcatgataaaacaactgtgaatatgaacaactgcaagggaatggtg------- |
195 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||| |||||| | ||||||||||||||| |
|
|
| T |
37790180 |
tttcgttatggaactcagtcttcgaaggagcaatgataagagatgtttcatgataaaacaaccgtgacgatgaac-agtgcaagggaatggtgacgacga |
37790082 |
T |
|
| Q |
196 |
acgacgacaaaggaaaggggacacggaccgttgccttttctttggggtttcagttcaatccacaaaaacgaggaagc |
272 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37790081 |
acgacgacaaaggtaatgggacacggaccgttgccttttctttggggtttcagttcaatccacaaaaacgaggaagc |
37790005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University