View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21169_high_14 (Length: 265)
Name: NF21169_high_14
Description: NF21169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21169_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 28437875 - 28438117
Alignment:
| Q |
9 |
agcagagattagcaaccttgtttgaagataataacaggaaagaaagtggaactgttttgctttctcaggttagcattgaaaagcctcaacctattttgtt |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28437875 |
agcaaagattagcaaccttgtttgaagataataacaggaaagagagtggaactgttttgctttctcaggttagcattgaaaagcctcaacctattttgtt |
28437974 |
T |
|
| Q |
109 |
tcagaatcttgagatttcaaaggctgagatgtttcaagttggtggtggtggtgattcaagaaaggaaggtgcaagtgaatggttctttggtatgaattct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28437975 |
tcagaatcttgagatttcaaaggctgagatgtttcaagttggtggtggtggtgattcaagaaaggaaggtgcaagtgaatggttctttggtatgaattct |
28438074 |
T |
|
| Q |
209 |
tattcatctgtgatggctccttcaacaactactgatcttagtg |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28438075 |
tattcatctgtgatggctcctacaacaactactgatcttagtg |
28438117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University