View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21169_high_19 (Length: 242)
Name: NF21169_high_19
Description: NF21169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21169_high_19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 38326431 - 38326647
Alignment:
| Q |
18 |
gcaaaatgatctggacttgttctgctaaattttatcaaaattgattgcattctaacttcttcacatacccaccacccttggtttactgtttaaaagaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
38326431 |
gcaaaatgatctggacttgttctgctaaattttatcaaaattgattgcattctaacttcttcacataccctctacccttggtttactgtttaaaagaatg |
38326530 |
T |
 |
| Q |
118 |
caactagaggtctagagagatagtcacattaactagactattgttgtgtttgagaataaaattgaactagaccaaacaaaattgttatcgcagttcagaa |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38326531 |
caactag--------agagatagtcacattaactagactattgttgtgtttgagaataaaattgaactagaccaaacaaaattgttatcgcagttcagaa |
38326622 |
T |
 |
| Q |
218 |
acacagaaccaagccgttactgatt |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38326623 |
acacagaaccaagccgttactgatt |
38326647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University