View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21169_high_24 (Length: 214)
Name: NF21169_high_24
Description: NF21169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21169_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 36457162 - 36457039
Alignment:
| Q |
1 |
ttattaatccactcccctatgttgctaattatttcatgtgttagtagcttgttgaattctgatactatgcagctcatttttggttcatcttgtgctaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457162 |
ttattaatccactcccctatgttgctaattatttcatgtgttagtaccttgttgaattctgatactatgcagctcatttttggttcatcttgtgctaaat |
36457063 |
T |
 |
| Q |
101 |
tttttgtttcacgtataatatttg |
124 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
36457062 |
tttttgtttcacgtgtaatatttg |
36457039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 195
Target Start/End: Complemental strand, 36456997 - 36456968
Alignment:
| Q |
166 |
tacataacaacagaacaatttataaaacca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36456997 |
tacataacaacagaacaatttataaaacca |
36456968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University