View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21169_high_9 (Length: 351)
Name: NF21169_high_9
Description: NF21169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21169_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 301
Target Start/End: Complemental strand, 56100818 - 56100528
Alignment:
| Q |
7 |
atagggtataggggttttacctttcaaaaaagcggtgacattgaatttgcaaacgattgaacatatgatcgttgaggttgcaagttcacgatagcttgtg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
56100818 |
atagggtataggggttttacctttcaaaaaagcggtgacattgaatttgcaaacgattgaacatatgattgttgaggttgcaggttcacgatcgcttgtg |
56100719 |
T |
|
| Q |
107 |
attccaatatcaccgcctcattgatttgttgttttattattcatttccactcactttattttcaagctagaaagggtttagagttttacctttcnnnnnn |
206 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
56100718 |
attccaatgtcaccgcctcattgatttgttgttttattattcatttccactcactttattttcaagctagaaagggtttagggttttacctttc--aaaa |
56100621 |
T |
|
| Q |
207 |
nnncggtgacattggatttgcaaacataccatcgattgtgatttcaatgtctaccgcctcttttttatttgttgttttattattcaattccactc |
301 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
56100620 |
aagcggtgacattggatttgcaaacatacgatcgattgtgattccaatgtctgccgc--cttttttatttgttgttttattattcaattccactc |
56100528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 70
Target Start/End: Complemental strand, 56100461 - 56100406
Alignment:
| Q |
15 |
taggggttttacctttcaaaaaagcggtgacattgaatttgcaaacgattgaacat |
70 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| ||| ||||||||||| |
|
|
| T |
56100461 |
taggggttttacctttcaaaaaagttgtgacattggatttacaagcgattgaacat |
56100406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 56100585 - 56100523
Alignment:
| Q |
102 |
ttgtgattccaatatca-ccgcctcattgatttgttgttttattattcatttccactcacttt |
163 |
Q |
| |
|
||||||||||||| || |||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
56100585 |
ttgtgattccaatgtctgccgccttttttatttgttgttttattattcaattccactcacttt |
56100523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University