View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21169_low_14 (Length: 273)
Name: NF21169_low_14
Description: NF21169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21169_low_14 |
 | |
|
| [»] scaffold0118 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 263
Target Start/End: Original strand, 13716190 - 13716440
Alignment:
| Q |
13 |
aaaggaacaacattgcagttttattaacaatcaaaggatctcgcagtgctaacccaccctcaactttgggcctgcaaatattgctcctagatacaattca |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13716190 |
aaagaaacaacattgcagttttattaacaatcaaaggatctcgcagtgctaacccaccctcaactttgggcctgcaaatattgctcctagatacaatgca |
13716289 |
T |
|
| Q |
113 |
aatcttctttgtcgaagtatctccgctccaaatgaaattagtaaacattcttctaagctgcttaatcaaagagataggccagacatacacatggaaggag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13716290 |
aatcttctttgtcgaagtatctccgctccaaatgaaattagtaaacattcttctaagctgcttaatcaaagagataggccagacatacacatggaaggag |
13716389 |
T |
|
| Q |
213 |
tatactagcatgcgaataaccaccgagttgacaagttgaaccctccctatg |
263 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
13716390 |
tatactagcatgcgaataattaccgagttgacaagttgaacgctccctatg |
13716440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 76 - 183
Target Start/End: Original strand, 36527 - 36634
Alignment:
| Q |
76 |
ctttgggcctgcaaatattgctcctagatacaattcaaatcttctttgtcgaagtatctccgctccaaatgaaattagtaaacattcttctaagctgctt |
175 |
Q |
| |
|
||||||||| |||| ||||||| || | ||||| |||||||| ||| | |||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
36527 |
ctttgggccaacaaagattgctcgtacagacaatgcaaatcttttttattgaagtatctccgctccaaataaaattagtaaacattcttctaagctgttt |
36626 |
T |
|
| Q |
176 |
aatcaaag |
183 |
Q |
| |
|
||| |||| |
|
|
| T |
36627 |
aatgaaag |
36634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University