View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21169_low_18 (Length: 247)

Name: NF21169_low_18
Description: NF21169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21169_low_18
NF21169_low_18
[»] chr5 (2 HSPs)
chr5 (125-205)||(27845706-27845786)
chr5 (48-111)||(27845659-27845721)


Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 125 - 205
Target Start/End: Original strand, 27845706 - 27845786
Alignment:
125 aacattttcattacacatgctatttatgtgtagcctaattcagtgagattcatttctattttaaccgattaaagaccatgt 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27845706 aacattttcattacacatgctatttatgtgtagcctaattcagtgagattcatttctattttaaccgattaaagaccatgt 27845786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 27845659 - 27845721
Alignment:
48 tagatcagacttaaaacatatcaattttgaaattgaccttatgctaacaacattttcattacac 111  Q
    ||||||||||||||| |||||  |||||||||||||||||||||||||||||||||||||||||    
27845659 tagatcagacttaaa-catatatattttgaaattgaccttatgctaacaacattttcattacac 27845721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University