View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21169_low_21 (Length: 241)
Name: NF21169_low_21
Description: NF21169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21169_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 31777853 - 31777634
Alignment:
| Q |
18 |
atgattttcaccaaaacagttttatttcaaccatacggatttatttttt-gcattagctaatatcgattttaagtgcatattgatttcnnnnnnnnncta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31777853 |
atgattttcaccaaaacagttttatttcaaccatacggatttatttttttgcattagctaatatcgattttaagtgcatattgatttcttttttttt-ta |
31777755 |
T |
 |
| Q |
117 |
caggggtatacatttttcttagaggaagacaggaacatgctacattttttcttagaggaggaagacagaaacatacatattgagttctcatctgttttat |
216 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31777754 |
caggagtatacattttttttagaggaagacaggaacatactacattttttcttagaggaggaagacagaaacatacatattgagttctcatctgttttat |
31777655 |
T |
 |
| Q |
217 |
tttattttaaagagatattga |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31777654 |
tttattttaaagagatattga |
31777634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University