View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2116_high_3 (Length: 434)
Name: NF2116_high_3
Description: NF2116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2116_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 19 - 425
Target Start/End: Complemental strand, 37006021 - 37005615
Alignment:
| Q |
19 |
ctttctctttagtgaaccgttccggtttaaattgttccggttcatcaaacacaaccgggtccctcattataagcttctgaaacccacataataactcacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37006021 |
ctttctctttagtgaaccgttccggtttaaattgttccggttcatcaaacacgaccgggtccctcattataagcttctgaaacccacataataactcacc |
37005922 |
T |
 |
| Q |
119 |
cttcttcacattgaacgcggagtcatatgagctgagctgaaaatcttttctggctcgaccaaattgaagtggaaccggtgggttcattcgaagggtttca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37005921 |
cttcttcacattgaacgcggagtcatatgagctgagctgaaaatcttttctggctcgaccaaattgaagtggaaccggtgggttcattcgaagggtttca |
37005822 |
T |
 |
| Q |
219 |
taaaccactgaatttattagttccaattcttttaacgagtcaaacccaagagtagaaccgcctttctctcgcgcttccttcctcaacttctcttgcaaac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37005821 |
taaaccactgaatttattagttccaattcttttaacgagtcaaacccaagagtagaaccgcctttctctcgcgcttccttcctcaacttctcttgcaaac |
37005722 |
T |
 |
| Q |
319 |
cggttggaccgttcgctatgctatctatcaattttggaagaaaaattgaaaacccaccatatgagttgaaacccaacacaaaaagcaaattgtggattgc |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37005721 |
cggttggaccgttcgctatgctatctatcaattttggaagaaaaattgaaaacccaccatatgagttgaaacccaacacaaaaagcaaattgtggattgc |
37005622 |
T |
 |
| Q |
419 |
ttcatct |
425 |
Q |
| |
|
||||||| |
|
|
| T |
37005621 |
ttcatct |
37005615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University