View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2116_high_6 (Length: 249)
Name: NF2116_high_6
Description: NF2116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2116_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 35312643 - 35312438
Alignment:
| Q |
1 |
atccaccaaacttaaactcaacactggtgctcgtgaagatcgatcatcattgattgcaaaatgtttataacttgttctctgtttagtttc--nnnnnnnn |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35312643 |
atccaccaaacttaaactcaacactggtgctcgtaaagatcgatcatcattgattgcaaaatgtttataacttgttctctgtttagtttctttttttttt |
35312544 |
T |
 |
| Q |
99 |
nnnggttacgttcgctgtttagtttgaataatcttttgctg------nnnnnnnnnnccacttaaataactattg--tataatattatattgaacattat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35312543 |
tttggttacgttcgctgtttagtttgaataatcttttgctgttttttttttttttttccacttaaataactattgtatataatattatattgaacattat |
35312444 |
T |
 |
| Q |
191 |
acacat |
196 |
Q |
| |
|
|||||| |
|
|
| T |
35312443 |
acacat |
35312438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University