View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2116_low_13 (Length: 210)
Name: NF2116_low_13
Description: NF2116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2116_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 106 - 193
Target Start/End: Complemental strand, 10163642 - 10163555
Alignment:
| Q |
106 |
cttgatctctttcaatggctctatggtttgtggtttttgcaaatatatggatgcacatggataatggagctaattataataggaaaag |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10163642 |
cttgatctctttcaatggctctatggtttgtggtttttgcaaatatatagatgcacatggataatggagctaattataataggaaaag |
10163555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 10163710 - 10163658
Alignment:
| Q |
29 |
gagcagcacagacacaaaaactggcccccaatctgacatcttcactcactctt |
81 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10163710 |
gagcaccactgacacaaaaactggcccccaatctgacatcttcactcactctt |
10163658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University