View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21170_low_10 (Length: 272)
Name: NF21170_low_10
Description: NF21170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21170_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 25 - 260
Target Start/End: Complemental strand, 12430524 - 12430289
Alignment:
| Q |
25 |
gggtgtccaaattatgtaattggaacaaatctagtattttgagaaatgcaagggatggaacaagaaatccattttgcactctaagtctgatgaatgcaac |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12430524 |
gggtgtccaaattatgtaattggaacaaatctagtattttgagaaatgcaagggatggaacaagagatccattttgcactctaagtctgatgaatgcaac |
12430425 |
T |
 |
| Q |
125 |
aacnnnnnnnngaatcagatgaatgcaacaacttatagtttgtgtaagctgnnnnnnnnnnnnnnnnnnnnnnnnncagaagtacaaaagtttgtccttg |
224 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12430424 |
aacttttttttgaatcagatgaatgcaacaacttatagtttgtgtaagctgtatttatttatttattatatatttacagaagtacaaaagtttgtccttg |
12430325 |
T |
 |
| Q |
225 |
acacacctttaattataaaatattgtaatgtaacat |
260 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12430324 |
acaaacctttaattataaaatattgtaatgtaacat |
12430289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University