View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21170_low_11 (Length: 231)
Name: NF21170_low_11
Description: NF21170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21170_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 56 - 224
Target Start/End: Original strand, 51577608 - 51577773
Alignment:
| Q |
56 |
atttgatttgatgattattataataaattaaaacggaagaagattattggaagaagttttaagaaagtggggtggggggtaaagtttgaaactttatctg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51577608 |
atttgatttgatgattattataataaattaaaacggaagaagattattggaagaaattttaagaa-gtggggtggggggtaaagtttgaaactttatctg |
51577706 |
T |
|
| Q |
156 |
tgcgtgtgaagtggggttttggttccttgtttgggtgtgagtgaaaaagtgttgtgaattgtgatgatg |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51577707 |
tgcgtgtgaagtggggttttggttacttgtttgg--gtgagtgaaaaagtgttgtgaattgtgatgatg |
51577773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University