View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21170_low_9 (Length: 276)
Name: NF21170_low_9
Description: NF21170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21170_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 78 - 228
Target Start/End: Complemental strand, 909825 - 909675
Alignment:
| Q |
78 |
ctatgtgtaagagcttgacagttgactctatggtgtagaaagacttattgctgcatgtttgttactgttaatcttcagtattataaactatattttgatc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
909825 |
ctatgtgtaagagcttgacagttgactctatggtgtagaaagacttattgctgcatgtttgttactgttaatcttcagtattataaactatattttgatc |
909726 |
T |
 |
| Q |
178 |
tgcatccaattattcttattttcttgaatcaatgtggatgatgtagtatat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
909725 |
tgcatccaattattcttattttcttgaatcaatgtggatgatatagtatat |
909675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University