View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21171_low_8 (Length: 222)
Name: NF21171_low_8
Description: NF21171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21171_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 42 - 205
Target Start/End: Complemental strand, 48798000 - 48797845
Alignment:
| Q |
42 |
cagtatcaatattttcaaatagtatgagcattagcactaccatttctcacagttgcttcaaattagctcggtctatctaaattaagaagctttagcttat |
141 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48798000 |
cagtatcaatattttcagatagtatgagcattagcactaccatttctgacacttgcttcaaattagctcggtctatctaaattaagaagctttagcttat |
48797901 |
T |
 |
| Q |
142 |
aacacaaatagtcaaatactaatcttttcgtctatatgaatatgcagattttgcaatagaatga |
205 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48797900 |
aacaca--------aatactaatcttttcgtctatatgaatatgcagattttgcaatagaatga |
48797845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University