View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21171_low_8 (Length: 222)

Name: NF21171_low_8
Description: NF21171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21171_low_8
NF21171_low_8
[»] chr1 (1 HSPs)
chr1 (42-205)||(48797845-48798000)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 42 - 205
Target Start/End: Complemental strand, 48798000 - 48797845
Alignment:
42 cagtatcaatattttcaaatagtatgagcattagcactaccatttctcacagttgcttcaaattagctcggtctatctaaattaagaagctttagcttat 141  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||    
48798000 cagtatcaatattttcagatagtatgagcattagcactaccatttctgacacttgcttcaaattagctcggtctatctaaattaagaagctttagcttat 48797901  T
142 aacacaaatagtcaaatactaatcttttcgtctatatgaatatgcagattttgcaatagaatga 205  Q
    ||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||    
48797900 aacaca--------aatactaatcttttcgtctatatgaatatgcagattttgcaatagaatga 48797845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University