View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21172_low_12 (Length: 212)
Name: NF21172_low_12
Description: NF21172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21172_low_12 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 38 - 212
Target Start/End: Original strand, 31698674 - 31698848
Alignment:
| Q |
38 |
aagaaaatgtgtacaaatattattgtcagttaaattgggcatgtttatcaacttttgttttagtcaatcaattaatctcatttaaagtaaatcagcatag |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31698674 |
aagaaaatgtgtacaaatattattgtcagttaaattgggcatgtttatcaacttttgttttagtcaatcaattaatctcatttaaagtaaatcagcatag |
31698773 |
T |
 |
| Q |
138 |
aagtacagggcgataagcaagaaaccatttcctaaaatataaataatgctcagattgaattattcttaaccctat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31698774 |
aagtacagggcgataagcaagaaaccattttctaaaatataaataatgctaagattgaattattcttaaccctat |
31698848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 46
Target Start/End: Complemental strand, 31698667 - 31698632
Alignment:
| Q |
11 |
tctatagcatctattatgctttttgataagaaaatg |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31698667 |
tctatagcatctattatgctttttgataagaaaatg |
31698632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University