View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21172_low_6 (Length: 279)
Name: NF21172_low_6
Description: NF21172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21172_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 23 - 222
Target Start/End: Original strand, 4509151 - 4509350
Alignment:
| Q |
23 |
cacagacccatcagcattgcatggagacaagtaatgtttctagttccacggtggctgacattgatgataatcccaccattgccggcagtgttcgggatgt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4509151 |
cacagacccatcagcattgcatggagacaagtaatgtttctagttccacggtggctgacattgatgataatcccaccattgccggcggtgttcgggatgt |
4509250 |
T |
 |
| Q |
123 |
ttatggtgaggatagagccactgaggatcagtttgttactccttggagtgttactgttgctaggtgtgttatgtgacttgtaatttgtaatcataatcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4509251 |
ttatggtgaggatagagccactgaggatcagtttgttactccttggagtgttactgttgctaggtgtgttatgtgacttgtaatttgtaatcataatcat |
4509350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 222 - 259
Target Start/End: Original strand, 4509338 - 4509375
Alignment:
| Q |
222 |
taatcataatcatcatattcatattgtaacgtagcttt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4509338 |
taatcataatcatcatattcatattgtaacgtagcttt |
4509375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 118 - 187
Target Start/End: Complemental strand, 43435264 - 43435195
Alignment:
| Q |
118 |
gatgtttatggtgaggatagagccactgaggatcagtttgttactccttggagtgttactgttgctaggt |
187 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
43435264 |
gatgtttatggcgaggataaggccactgaggatcactttgtgactccttggagtgtttctgttgctaggt |
43435195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University