View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21172_low_8 (Length: 260)
Name: NF21172_low_8
Description: NF21172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21172_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 242
Target Start/End: Original strand, 10748327 - 10748562
Alignment:
| Q |
13 |
aaaatcataagtattctttctttaattaaaatcatcatttcttttctatgaaacaaaatcataaagattaactgtgtaaaacgaatt-----attgcatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||| |
|
|
| T |
10748327 |
aaaatcataagtattctttctttaattaaaatcattatttcttttctatgaaacaaaatcataaagattaactgtgtaaaatgaattactgcattacatt |
10748426 |
T |
 |
| Q |
108 |
gcattgaatgggaatacagacagtagcactatgtatatatagaagggtctaattttatcaaaataaaaactagtcag-ttccaacatttttgctactaat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10748427 |
gcattgaatgggaatacagacagtagcactatgtatatatagaagggtctaattttatcaaaataaaaactagtcagtttccaacatttttgctactaat |
10748526 |
T |
 |
| Q |
207 |
tttattttgactccgattctagtttataataaaatc |
242 |
Q |
| |
|
||| ||||||||||||||||| |||| ||||||||| |
|
|
| T |
10748527 |
tttgttttgactccgattctaatttaaaataaaatc |
10748562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University