View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21174_low_10 (Length: 291)
Name: NF21174_low_10
Description: NF21174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21174_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 133 - 283
Target Start/End: Complemental strand, 36199228 - 36199078
Alignment:
| Q |
133 |
cattaaactgatacaagttaggagagagaaaatgaaaatgatgagatatgatgagaaagagattgtactctgccatatcttccagttggatcaacttcaa |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36199228 |
cattaaactgatacaagttaggagagagaaaatgaaaatgatgagatatgatgagaaagagattgtactctgccatatcttccagttggatcaacttcaa |
36199129 |
T |
|
| Q |
233 |
caaactcagaatcatcttcttcaaggtgtgtcactccattcattctctgct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36199128 |
caaactcagaatcatcttcttcaaggtgtgtcactccattcattctctgct |
36199078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 196 - 242
Target Start/End: Original strand, 47006725 - 47006771
Alignment:
| Q |
196 |
tgtactctgccatatcttccagttggatcaacttcaacaaactcaga |
242 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| | ||||||||| |
|
|
| T |
47006725 |
tgtactcttccatatcttccagtaggatcaacttctataaactcaga |
47006771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 78
Target Start/End: Complemental strand, 49082905 - 49082847
Alignment:
| Q |
20 |
cagcaacatcaagtttattctgtggaaatgttatgttttgaggaggcatgataatctgt |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
49082905 |
cagcaacatcaagtttattctgtggaaatgttatattttgaggaggcatggtaatctgt |
49082847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 198 - 275
Target Start/End: Original strand, 47355140 - 47355217
Alignment:
| Q |
198 |
tactctgccatatcttccagttggatcaacttcaacaaactcagaatcatcttcttcaaggtgtgtcactccattcat |
275 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||| ||||| |||||| |||||| |||||||| | |||||| |
|
|
| T |
47355140 |
tactctgccatatctaccggttggatcaacttcaacaaaatcagagtcatctgtttcaagctgtgtcacacaattcat |
47355217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University