View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21174_low_13 (Length: 250)
Name: NF21174_low_13
Description: NF21174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21174_low_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 45050119 - 45050353
Alignment:
| Q |
18 |
aaaatcaatgtaattgtcatgcttcttctctcaactcaagtannnnnnnnn--ctgaacacaacatctctaaaattttagttttgnnnnnnnnctataat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45050119 |
aaaatcaatgtaattgtcatgcttcttctctcaactcaagtatttttttttttctgaacacaacatctctaaaattttagttttgaaaaaaaactataat |
45050218 |
T |
 |
| Q |
116 |
ttatttgtttcatttatttttatcatagttcattaaaaaatttaagctgattttcaaattcacaataataaatgtaatccttttaaaggtttttagaggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45050219 |
ttatttgtttcatttatttttatcatagttcattaaaaaatttaagctgattttcaaattcacaataataaatgtaatccttttaaaggtttttagaggt |
45050318 |
T |
 |
| Q |
216 |
gcaacacatagaatttttctaatactactttcggt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45050319 |
gcaacacatagaatttttctaatactactttcggt |
45050353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University