View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21175_high_21 (Length: 290)

Name: NF21175_high_21
Description: NF21175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21175_high_21
NF21175_high_21
[»] chr5 (1 HSPs)
chr5 (1-185)||(16547131-16547315)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 16547315 - 16547131
Alignment:
1 catgccctcctccgccatgatgatcgccatgtcgatgaccttcatcctctccttgattttcagctttagagacttgggcaccattattcttagtctcgtt 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
16547315 catgccctcctccgccatgatgatcgccatgtcaatgaccttcatcctctccttgattttcagctttagagacttgggcaccattattcttagtctcttt 16547216  T
101 tacttttgaggcaccctgaacatcatgcaactcgtgaagcttttttagtcttgaagcaaagtcttcattgcttgtgcttgtgttg 185  Q
    ||||||||||||||| |||| |||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||    
16547215 tacttttgaggcaccttgaatatcatgcagctcgcgaagcttttttattcttgaagcaaagtcttcattgcttgtgcttgtgttg 16547131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University