View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21175_high_21 (Length: 290)
Name: NF21175_high_21
Description: NF21175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21175_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 16547315 - 16547131
Alignment:
| Q |
1 |
catgccctcctccgccatgatgatcgccatgtcgatgaccttcatcctctccttgattttcagctttagagacttgggcaccattattcttagtctcgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16547315 |
catgccctcctccgccatgatgatcgccatgtcaatgaccttcatcctctccttgattttcagctttagagacttgggcaccattattcttagtctcttt |
16547216 |
T |
 |
| Q |
101 |
tacttttgaggcaccctgaacatcatgcaactcgtgaagcttttttagtcttgaagcaaagtcttcattgcttgtgcttgtgttg |
185 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16547215 |
tacttttgaggcaccttgaatatcatgcagctcgcgaagcttttttattcttgaagcaaagtcttcattgcttgtgcttgtgttg |
16547131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University