View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21175_high_25 (Length: 209)
Name: NF21175_high_25
Description: NF21175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21175_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 101 - 192
Target Start/End: Original strand, 12457241 - 12457332
Alignment:
| Q |
101 |
tcggaatgcaatctcaaaaggagatcatagctgttcatagagacactgcaactatttcagagtcaacaatatgtttgcttatggatagattt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12457241 |
tcggaatgcaatctcaaaaggagatcatagctgttcatagagacactgcaactatttcagagtcaacaatatgtttgcttatggatagattt |
12457332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 12457141 - 12457185
Alignment:
| Q |
1 |
atgtcagccatggtagaagtatggattggggaattagccaagctc |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12457141 |
atgtcagccatggtagaagtatggattggggaattagccaagctc |
12457185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 113 - 192
Target Start/End: Original strand, 12473310 - 12473389
Alignment:
| Q |
113 |
ctcaaaaggagatcatagctgttcatagagacactgcaactatttcagagtcaacaatatgtttgcttatggatagattt |
192 |
Q |
| |
|
||||||||||| |||||| || ||| ||||||||| |||| | || ||||||||||||||||||||||||||||||||| |
|
|
| T |
12473310 |
ctcaaaaggaggtcataggtgctcaaagagacactacaaccttgtctgagtcaacaatatgtttgcttatggatagattt |
12473389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University