View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21176_high_24 (Length: 238)
Name: NF21176_high_24
Description: NF21176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21176_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 42452587 - 42452719
Alignment:
| Q |
1 |
taggtgacttgaatgtcgtgaaatgatcgacgttatctttaattagtggatgaaataaaattattttcatggaaatggttaccttcttacatacttactt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42452587 |
taggtgacttgaatgttgtgaaatgatcgacgttatctttaattagtggatgaaataaaattattttcatggaaatggttaccttcttacatacttactt |
42452686 |
T |
|
| Q |
101 |
aattagacaatcgtctattgttttcaccgaatc |
133 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
42452687 |
aattagacaatcctctattgttttcaccgaatc |
42452719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University