View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21176_low_24 (Length: 238)

Name: NF21176_low_24
Description: NF21176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21176_low_24
NF21176_low_24
[»] chr1 (1 HSPs)
chr1 (1-133)||(42452587-42452719)


Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 42452587 - 42452719
Alignment:
1 taggtgacttgaatgtcgtgaaatgatcgacgttatctttaattagtggatgaaataaaattattttcatggaaatggttaccttcttacatacttactt 100  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42452587 taggtgacttgaatgttgtgaaatgatcgacgttatctttaattagtggatgaaataaaattattttcatggaaatggttaccttcttacatacttactt 42452686  T
101 aattagacaatcgtctattgttttcaccgaatc 133  Q
    |||||||||||| ||||||||||||||||||||    
42452687 aattagacaatcctctattgttttcaccgaatc 42452719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University