View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21176_low_8 (Length: 386)
Name: NF21176_low_8
Description: NF21176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21176_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 8e-43; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 178 - 270
Target Start/End: Complemental strand, 43163226 - 43163134
Alignment:
| Q |
178 |
aagcatgagtgttgatcctaaacaaaggatttattctattttgcaatgtgtcagtattgaaagcaatgctaatacgctatttcttgaggattc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43163226 |
aagcatgagtgttgatcctaaacaaaggatttattctattttgcaatgtgtcagtattgaaagcaatgctaatacgctatttcttaaggattc |
43163134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 20 - 108
Target Start/End: Complemental strand, 43163384 - 43163296
Alignment:
| Q |
20 |
ggatagtggagctggctgttcaatgcgttgctgtacaaaggtaggtagcaaaccattgaactacactgcactgctccatcttactaacc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43163384 |
ggatagtggagctggctgttcaatgcgttgctgtacaaaggtaggtagcaaaccattgaactacactgcactgctccatcttactaacc |
43163296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 325 - 364
Target Start/End: Complemental strand, 43163135 - 43163096
Alignment:
| Q |
325 |
tcccacggagtatactgcaatggtcatatttcttttagtt |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43163135 |
tcccacggagtatactgcaatggtcatatttcttttagtt |
43163096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 25746348 - 25746312
Alignment:
| Q |
184 |
gagtgttgatcctaaacaaaggatttattctattttg |
220 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| |
|
|
| T |
25746348 |
gagtgttgatcctaaacaaaggatttagtcaattttg |
25746312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 184 - 252
Target Start/End: Complemental strand, 25754827 - 25754759
Alignment:
| Q |
184 |
gagtgttgatcctaaacaaaggatttattctattttgcaatgtgtcagtattgaaagcaatgctaatac |
252 |
Q |
| |
|
||||||||||||||||||||||||||| || || ||| || |||| |||||||||| ||||||||| |
|
|
| T |
25754827 |
gagtgttgatcctaaacaaaggatttagtcaatgttgtgatacgtcaatattgaaagctttgctaatac |
25754759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University