View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21177_high_6 (Length: 363)
Name: NF21177_high_6
Description: NF21177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21177_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 24 - 347
Target Start/End: Original strand, 4109228 - 4109551
Alignment:
| Q |
24 |
tgtccatgagttccaactcctcctcttccttatccatagacgttgatgaatcagcagaaacacgcatccaccgtctcatatcagaacatccagttatcat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4109228 |
tgtccatgagttccaactcctcctcttccttatccatagacgttgatgaatcagcagaaacacgcatccaccgtctcatatcagaacatccagttatcat |
4109327 |
T |
 |
| Q |
124 |
cttcacacgttcctcttgctgcatgtgtcatgtcatgaagaagcttctctccaccataggtgttaatcccaccgtcatcgaattagacgacaacgagatc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4109328 |
cttcacacgttcctcttgctgcatgtgtcatgtcatgaagaagcttctctccaccataggtgttaatcccaccgtcatcgaattagacgacaacgagatc |
4109427 |
T |
 |
| Q |
224 |
gcctctttgtcgtctgacgatgacgatgatcttgcttccgtcctccgtaaccgctctcctgctgtcttcatcggtggtgcttgcgttggtggtcttgaga |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4109428 |
gcctctttgtcgtctgacgatgacgatgatcttgcttccgtcctccgtaaccgctctcctgctgtcttcattggtggtgcttgcgttggtggtcttgaga |
4109527 |
T |
 |
| Q |
324 |
gtcttgttgctcttcatgttggtg |
347 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4109528 |
gtcttgttgctcttcatgttggtg |
4109551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 78 - 223
Target Start/End: Complemental strand, 48154189 - 48154041
Alignment:
| Q |
78 |
cagaaacacgcatccaccgtctcatatcagaacatccagttatcatcttcacacgttcctctt---gctgcatgtgtcatgtcatgaagaagcttctctc |
174 |
Q |
| |
|
||||||| || ||| |||| |||||||||||||| || || ||||||||||| || ||||| | |||||||||| |||||||||| ||| || |||| |
|
|
| T |
48154189 |
cagaaactcgaatcaaccgcctcatatcagaacaccctgtcatcatcttcacccgatcctcctcatgctgcatgtgccatgtcatgaggaatctcctctt |
48154090 |
T |
 |
| Q |
175 |
caccataggtgttaatcccaccgtcatcgaattagacgacaacgagatc |
223 |
Q |
| |
|
|||||| || ||| |||||||||| ||| |||| || |||||||||||| |
|
|
| T |
48154089 |
caccatcggcgttcatcccaccgttatccaattggatgacaacgagatc |
48154041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University