View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21177_high_7 (Length: 354)
Name: NF21177_high_7
Description: NF21177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21177_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 42457330 - 42457095
Alignment:
| Q |
17 |
tatgtgaccaaaatacaatcatatttctatgtgaccagattccgagaggaaggagtttctaaacaaaagtcatcaccatcgacgactactggttggccag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42457330 |
tatgtgaccaaaatacaatcatatttctatgtgaccagattccgagaggaaggagtttctaaacaaaagtcatcaccatcgacgactactggttggccag |
42457231 |
T |
 |
| Q |
117 |
agattagacaatgccctgtttagtggcaatgggaaaactgttctagctaactttctttattgacatgacaccaacataatagtgcnnnnnnnnnnnnnca |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42457230 |
agattagacaatgccctgtttagcggcaatgggaaaactgttctagctaactttctttattgacatgacaccaacataatagtgcaaaaaaaaaaaaaca |
42457131 |
T |
 |
| Q |
217 |
aatttgataatcaataaatgtttatgttatttttta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42457130 |
aatttgataatcaataaatgtttatgttatttttta |
42457095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 247 - 341
Target Start/End: Complemental strand, 42456955 - 42456861
Alignment:
| Q |
247 |
tttttaactttttatactatgcaagtttgcacatgatagaaaaatccataatgaatttatttattattgatttgatcgaccatacttttatgata |
341 |
Q |
| |
|
|||||||||| |||||||||| |||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42456955 |
tttttaacttcttatactatgtaagtttgcgcatgatagaaaaatccatcataaatttatttattattgatttgatcgaccatacttttatgata |
42456861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 264 - 297
Target Start/End: Complemental strand, 32801068 - 32801035
Alignment:
| Q |
264 |
tatgcaagtttgcacatgatagaaaaatccataa |
297 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
32801068 |
tatgcaagtttgcacatgatagaaaaatctataa |
32801035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 247 - 290
Target Start/End: Original strand, 11056980 - 11057023
Alignment:
| Q |
247 |
tttttaactttttatactatgcaagtttgcacatgatagaaaaa |
290 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
11056980 |
tttttatctttttatgctatgcaagtttgcacatgataaaaaaa |
11057023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 248 - 290
Target Start/End: Complemental strand, 20261468 - 20261426
Alignment:
| Q |
248 |
ttttaactttttatactatgcaagtttgcacatgatagaaaaa |
290 |
Q |
| |
|
|||| |||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
20261468 |
ttttgacttcttatactatgcaagttcgcacatgatagaaaaa |
20261426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 256 - 292
Target Start/End: Complemental strand, 25119638 - 25119602
Alignment:
| Q |
256 |
ttttatactatgcaagtttgcacatgatagaaaaatc |
292 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
25119638 |
ttttatactatacaagtttgcacatgatcgaaaaatc |
25119602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 248 - 290
Target Start/End: Complemental strand, 5329030 - 5328988
Alignment:
| Q |
248 |
ttttaactttttatactatgcaagtttgcacatgatagaaaaa |
290 |
Q |
| |
|
|||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
5329030 |
ttttgactttttaaactatgcaagtttggacatgatagaaaaa |
5328988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 32505484 - 32505517
Alignment:
| Q |
256 |
ttttatactatgcaagtttgcacatgatagaaaa |
289 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
32505484 |
ttttatactatgcaagtttgcaaatgatagaaaa |
32505517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 247 - 283
Target Start/End: Original strand, 4171575 - 4171611
Alignment:
| Q |
247 |
tttttaactttttatactatgcaagtttgcacatgat |
283 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
4171575 |
tttttaacttcttatactatgcaagttcgcacatgat |
4171611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 264 - 292
Target Start/End: Complemental strand, 34671582 - 34671554
Alignment:
| Q |
264 |
tatgcaagtttgcacatgatagaaaaatc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34671582 |
tatgcaagtttgcacatgatagaaaaatc |
34671554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University