View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21179_high_17 (Length: 243)
Name: NF21179_high_17
Description: NF21179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21179_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 44 - 226
Target Start/End: Complemental strand, 4347726 - 4347545
Alignment:
| Q |
44 |
gtgttaatcttcactatttttctataagtgaaggatttatggttcaaacatcgaccattgcatataaatgtctatagaacttattaactaagttgcactt |
143 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4347726 |
gtgttaatcttcactatttttttataagtgaaggattcatggtt-aaacatcggccattgcatataaatgtctatagaacttattaactaagttgcactt |
4347628 |
T |
 |
| Q |
144 |
acatgacaaagatcaagtaaccaaaaacatccatcaaaattaactttctttcatttgttaaaacatatgctacttgttacatg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4347627 |
acatgacaaagatcaagtaaccaaaaacatccattaaaattaactttctttcatttgttaaaacatatgctacttgttacatg |
4347545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University