View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2117_high_16 (Length: 341)
Name: NF2117_high_16
Description: NF2117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2117_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 17 - 101
Target Start/End: Complemental strand, 53757829 - 53757745
Alignment:
| Q |
17 |
aatatgtgagggaatggtagaggtgtctttttgcagataatgatgcaaaagagattgaggtgtcccataacagcaaccttttaaa |
101 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53757829 |
aatatgtgagggaatggcagaggtgtctttttgcagataatgatgcaaaagagattgaggtgtcccataacagcaaccttttaaa |
53757745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 130 - 205
Target Start/End: Complemental strand, 53757742 - 53757667
Alignment:
| Q |
130 |
gattgaattttaaagagaaaatatgtgaggggatggcagattgaggtgtgtctttttgcggatatggatggccatg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53757742 |
gattgaattttaaagagaaaatatgtgagggaatggcagattgaggtgtgtctttttgcggatatggatggccatg |
53757667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 331
Target Start/End: Complemental strand, 53757596 - 53757546
Alignment:
| Q |
281 |
atgttgagagtctgttgtagactagtgtgtgctttttagatccaacctttg |
331 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53757596 |
atgttgagagtccgttgtagactgatgtgtgctttttagatccaacctttg |
53757546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 98 - 194
Target Start/End: Complemental strand, 29821706 - 29821610
Alignment:
| Q |
98 |
taaaaacgcagaaatagtaagataatgatgcagattgaattttaaagagaaaatatgtgaggggatggcagattgaggtgtgtctttttgcggatat |
194 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||| |||||||||||||||||||||| || |||||||| ||||||||||||||| ||||| |
|
|
| T |
29821706 |
taaaaacccagaaatagtaagataatgatgcatgttgaatgttaaagagaaaatatgtgagggaatagcagattggggtgtgtctttttgcagatat |
29821610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 267 - 318
Target Start/End: Complemental strand, 29821550 - 29821499
Alignment:
| Q |
267 |
atagaaattatcaaatgttgagagtctgttgtagactagtgtgtgcttttta |
318 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
29821550 |
atagaaattatcaaatgttgcgagtccattgtagactagtgtgtgcttttta |
29821499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 57; Significance: 9e-24; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 98 - 194
Target Start/End: Complemental strand, 4030550 - 4030455
Alignment:
| Q |
98 |
taaaaacgcagaaatagtaagataatgatgcagattgaattttaaagagaaaatatgtgaggggatggcagattgaggtgtgtctttttgcggatat |
194 |
Q |
| |
|
||||||| || ||||||||||||||||||||| |||||| |||||||||||||||||||||| || |||||||| ||||||||||||||| ||||| |
|
|
| T |
4030550 |
taaaaacccaaaaatagtaagataatgatgcatgttgaatgttaaagagaaaatatgtgagggaatagcagattg-ggtgtgtctttttgcagatat |
4030455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 265 - 327
Target Start/End: Complemental strand, 28928592 - 28928530
Alignment:
| Q |
265 |
taatagaaattatcaaatgttgagagtctgttgtagactagtgtgtgctttttagatccaacc |
327 |
Q |
| |
|
||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
28928592 |
taatagaaattataaaatgttgagatttcattgtagactagtgtgtgctttttagatccaacc |
28928530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 267 - 324
Target Start/End: Complemental strand, 4030382 - 4030325
Alignment:
| Q |
267 |
atagaaattatcaaatgttgagagtctgttgtagactagtgtgtgctttttagatcca |
324 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||| ||||| |
|
|
| T |
4030382 |
atagaaattatcaaatgttgcaagtccattgtagactagtgtgtgctttttaaatcca |
4030325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University