View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2117_high_30 (Length: 216)
Name: NF2117_high_30
Description: NF2117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2117_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 24 - 198
Target Start/End: Complemental strand, 50093350 - 50093176
Alignment:
| Q |
24 |
atatatcaatttgttaatatgtgcttctcccnnnnnnngaatatgtgatgagtggaatttctgtcatcgtatgttagaattcaaaaaagaaaattattgt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50093350 |
atatatcaatttgttaatatgtgcttctcccaaaaaaagaatatgtgatgagtggaatttctgtcatcgtatgttagaattcaaaaaagaaaattattgt |
50093251 |
T |
|
| Q |
124 |
cttaaaataacttagaggtaaaacacactgactaaaggtgagattttatgtgtaaccccttcggttgaatctgtg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50093250 |
cttaaaataacttagaggtaaaacacactgactaaaggtgagattttatgtgtaaccccttcggttgaatctgtg |
50093176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University