View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2117_high_32 (Length: 208)

Name: NF2117_high_32
Description: NF2117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2117_high_32
NF2117_high_32
[»] chr3 (1 HSPs)
chr3 (24-190)||(50345267-50345434)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 24 - 190
Target Start/End: Complemental strand, 50345434 - 50345267
Alignment:
24 taaagaccaa-agagtaaaagacccttgtagaggctgctacagaaaaggaatgaggttttccaactaactttatcccatgtagtttcttaaaaataaatc 122  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
50345434 taaagaccaacagagtaaaagacccttgtagaggctgctacagaaaaggaatgaggttttcaaactaactttatcccatgtagtttcttaaaaataaatc 50345335  T
123 atcccatgatgcgtccctactagatatttaacagttaggttactgactagcggggatatacctaaggg 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50345334 atcccatgatgcgtccctactagatatttaacagttaggttactgactagcggggatatacctaaggg 50345267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University