View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2117_low_32 (Length: 245)
Name: NF2117_low_32
Description: NF2117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2117_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 226
Target Start/End: Complemental strand, 46761619 - 46761402
Alignment:
| Q |
15 |
gtgaaatgaatacctgtttaacagcaagaagctctccagaatcgagattcataccaacgtaaacatgaccaaaggcaccacaaccgatcaactcgccttt |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46761619 |
gtgaaatgaatacctgtttgacagcaagaagctctccagaatcgagattcataccaacgtaaacatgaccaaaggcaccacaaccgatcaactcgccttt |
46761520 |
T |
 |
| Q |
115 |
gcgccatcgaattggaggaggaataggcggagaa------ggaggagaaggtttagagaaaactctagaattacggatgcaataaccgatcttatcaact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46761519 |
gcgccatcgaattggaggaggaataggcggagaaggagaaggaggagaaggtttagagaaaactctagaattacggatgcaataaccgatcttatcaact |
46761420 |
T |
 |
| Q |
209 |
agggttgttgttcctcct |
226 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46761419 |
agggttgttgttcctcct |
46761402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University