View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2117_low_38 (Length: 208)
Name: NF2117_low_38
Description: NF2117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2117_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 24 - 190
Target Start/End: Complemental strand, 50345434 - 50345267
Alignment:
| Q |
24 |
taaagaccaa-agagtaaaagacccttgtagaggctgctacagaaaaggaatgaggttttccaactaactttatcccatgtagtttcttaaaaataaatc |
122 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50345434 |
taaagaccaacagagtaaaagacccttgtagaggctgctacagaaaaggaatgaggttttcaaactaactttatcccatgtagtttcttaaaaataaatc |
50345335 |
T |
 |
| Q |
123 |
atcccatgatgcgtccctactagatatttaacagttaggttactgactagcggggatatacctaaggg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50345334 |
atcccatgatgcgtccctactagatatttaacagttaggttactgactagcggggatatacctaaggg |
50345267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University