View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21181_low_16 (Length: 243)
Name: NF21181_low_16
Description: NF21181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21181_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 2 - 228
Target Start/End: Original strand, 30958950 - 30959176
Alignment:
| Q |
2 |
tgctttctatagtgttggtaatgaagataggttgttggaagaatcaaggaattgtatgagtcatattcaagtgccagtaggaacagattttccttttggg |
101 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| || | |
|
|
| T |
30958950 |
tgctttctttagtgttggtaatgaagataggttgttggaagaatcaaggaattgtatgagtcatattcatgtgccagtaggagcagattttcctggtgtg |
30959049 |
T |
|
| Q |
102 |
aaagattatgatgattattttgatcatgattttcttgaaaatggtttggataaggggtttgagttgaattatattctgaaagaggaatgcataaggtgtt |
201 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
30959050 |
aaagattatgttgattattttgatcatgattttcttgaaaatggtttggataaggggtttgagttgaattatactatgaaagaggaatgctcaaggtgtt |
30959149 |
T |
|
| Q |
202 |
tgggaaatgaaggaggagattgtaaat |
228 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
30959150 |
tgggaagtgaaggaggagattgtaaat |
30959176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 134 - 228
Target Start/End: Original strand, 31012899 - 31012993
Alignment:
| Q |
134 |
tcttgaaaatggtttggataaggggtttgagttgaattatattctgaaagaggaatgcataaggtgtttgggaaatgaaggaggagattgtaaat |
228 |
Q |
| |
|
|||| ||| ||||||| |||| ||||||||| ||||||||| | ||||||||||||| || ||||||||||| ||||| |||||||||||||| |
|
|
| T |
31012899 |
tcttaaaagtggtttgaataatgggtttgaggtgaattatagtgtgaaagaggaatgtgcaaagtgtttgggaagtgaagaaggagattgtaaat |
31012993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University