View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21181_low_18 (Length: 234)
Name: NF21181_low_18
Description: NF21181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21181_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 43439730 - 43439555
Alignment:
| Q |
1 |
aataaaatagaagatgaaaccgaatccaacaattataataacataagnnnnnnnn-agagataattataataacataagatgatggtggatgttggcata |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439730 |
aataaaatagaagatgaaaccgaatccaacaattataataacataagtttttttttagagataattataataacataagatgatggtggatgttggcata |
43439631 |
T |
 |
| Q |
100 |
agagcacggtttttgacattttgtaatgcatccctgctcatattcagttagtccattacaataattatgaatgaat |
175 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439630 |
agagcacggtttttgacattttgtaatgtatccctgctcatattcagttagtccattacaataattatgaatgaat |
43439555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 114
Target Start/End: Complemental strand, 43424648 - 43424604
Alignment:
| Q |
70 |
taacataagatgatggtggatgttggcataagagcacggtttttg |
114 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| || |||||||| |
|
|
| T |
43424648 |
taacataagatgatggtagatgtcggcataagaacatggtttttg |
43424604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University