View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21181_low_20 (Length: 213)
Name: NF21181_low_20
Description: NF21181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21181_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 197
Target Start/End: Original strand, 38635189 - 38635369
Alignment:
| Q |
17 |
agagacccagttgcaacagtagtccgcagggataggagaactgtaaactctgaaacttgagaccatgtcttcaaccgcaaccgcaaccgcaaccgtcgtc |
116 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38635189 |
agagacccagtagcaacagtagtccgcagggataggagaactgtaaactctgaaacttgagaccatgtcttcaactgcaaccgcaaccgcaaccgtcgtc |
38635288 |
T |
 |
| Q |
117 |
ataggccctttttcaacaacttcatcttcgaatcgcaatgctagaaccacattttccgccaattttacttctagaagcttc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38635289 |
ataggccctttttcaacaacttcatcttcgaatcgcaatgctagaaccacatttgccgccaattttacttctagaagcttc |
38635369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University