View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21181_low_21 (Length: 210)
Name: NF21181_low_21
Description: NF21181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21181_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 53 - 166
Target Start/End: Original strand, 4402922 - 4403035
Alignment:
| Q |
53 |
catatcagcaacaaccttcatcagttattcatttctagaaataatattttctatgagctgcattttccttttcatgtttctccgtcatcttctacatcaa |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4402922 |
catatcagcaacaaccttcatcagttattcatttctagaaataatattttctatgagctgcattttccttttcatgtttcttcgtcatcttctacatcaa |
4403021 |
T |
 |
| Q |
153 |
gttcacctttacct |
166 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4403022 |
gttcacctttacct |
4403035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University