View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21181_low_6 (Length: 413)
Name: NF21181_low_6
Description: NF21181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21181_low_6 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 363; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 20 - 398
Target Start/End: Original strand, 6249164 - 6249542
Alignment:
| Q |
20 |
ttagcttccattgttgtctatgtaaaacagagaattccatcaatttcaaatgccactgtcttagatctatgcaagatcttctactcgatatgtacaacaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6249164 |
ttagcttccattgttgtctatgtaaaacagagaattccatcaatttcaaatgccactgtcttagatctatgcaagatcttctactcgatatgtacaacaa |
6249263 |
T |
|
| Q |
120 |
agaagaagaaaccaaacaatttatgatttcttctgtccggatcttccaaaaagtgttaccttcaattcaataaaaattagagttgctggaaaaatcactg |
219 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6249264 |
agaagaagaaaccaaacaattcatgatttcttatgtccggatcttccaaaaagtgttaccttcacttcaataaaaattagagttgctggaaaaatcactg |
6249363 |
T |
|
| Q |
220 |
aaggtttctctgcatctgacccgcgttaacccaacccgtgaaccgtacgacccgtaacccgctgaacccgcaacaaaaaaggggttgaaatgggcttctg |
319 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6249364 |
aaggtttctctgcatctaacccgcgttaacccaacccgtgaaccgtacgacccgtaacccgctgaacccgcaacaaaaaaggggttgaaatgggcttctg |
6249463 |
T |
|
| Q |
320 |
taggacacccgcgggttgggcagggttggtgttttgagcccgaacccgcccgacgcccacccctagacacatccctttg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6249464 |
taggacacccgcgggttgggcagggttggtgttttgagcccgaacccgcccgacgcccacccctagacacatccctttg |
6249542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 323 - 372
Target Start/End: Complemental strand, 43064364 - 43064315
Alignment:
| Q |
323 |
gacacccgcgggttgggcagggttggtgttttgagcccgaacccgcccga |
372 |
Q |
| |
|
|||||||||| ||||||| || |||| |||||| |||||||||||||||| |
|
|
| T |
43064364 |
gacacccgcgagttgggctggattggggttttgggcccgaacccgcccga |
43064315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 333; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 20 - 384
Target Start/End: Original strand, 43047320 - 43047684
Alignment:
| Q |
20 |
ttagcttccattgttgtctatgtaaaacagagaattccatcaatttcaaatgccactgtcttagatctatgcaagatcttctactcgatatgtacaacaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43047320 |
ttagcttccattgttgtctatgtaaaacagagaattccatcagtttcaaatgccactgtcttagatctatgcaagatcttctactcgatatgtacaacaa |
43047419 |
T |
|
| Q |
120 |
agaagaagaaaccaaacaatttatgatttcttctgtccggatcttccaaaaagtgttaccttcaattcaataaaaattagagttgctggaaaaatcactg |
219 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
43047420 |
agaagaagaaaccaaacaattcatgatttcttctgtccggatcttccaaaaagtgttaccttcacttcaataaaaattagagttgctggaaaaatcaccg |
43047519 |
T |
|
| Q |
220 |
aaggtttctctgcatctgacccgcgttaacccaacccgtgaaccgtacgacccgtaacccgctgaacccgcaacaaaaaaggggttgaaatgggcttctg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
43047520 |
aaggtttctctgcatctgacccgcgttaacccaacccgtgaaccgtacgacccgtaacccgctggacccgcaacaaaaaaggggttgaaatgggcttatg |
43047619 |
T |
|
| Q |
320 |
taggacacccgcgggttgggcagggttggtgttttgagcccgaacccgcccgacgcccaccccta |
384 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43047620 |
taggacacccgcgggttgggctaggttggtgttttgagcccgaacccgcccgacgcccaccccta |
43047684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 384
Target Start/End: Original strand, 41120828 - 41120884
Alignment:
| Q |
328 |
ccgcgggttgggcagggttggtgttttgagcccgaacccgcccgacgcccaccccta |
384 |
Q |
| |
|
||||||||||||| |||| |||| |||| ||||||||||||||| | ||||||||| |
|
|
| T |
41120828 |
ccgcgggttgggctgggtgggtgctttggacccgaacccgcccgatgtccaccccta |
41120884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 384
Target Start/End: Complemental strand, 102321 - 102265
Alignment:
| Q |
328 |
ccgcgggttgggcagggttggtgttttgagcccgaacccgcccgacgcccaccccta |
384 |
Q |
| |
|
||||||||||||| |||| |||| |||| ||||||||||||||| | ||||||||| |
|
|
| T |
102321 |
ccgcgggttgggctgggtgggtgctttggacccgaacccgcccgatgtccaccccta |
102265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University