View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21182_high_10 (Length: 341)
Name: NF21182_high_10
Description: NF21182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21182_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 309
Target Start/End: Complemental strand, 32412989 - 32412684
Alignment:
| Q |
11 |
aatgagaaagagactc-tagtgtggtgtacgtgttaccaatattatttttattgatcgaggcnnnnnnnnnnnnnnnnnnnngcaactaactaactccac |
109 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
32412989 |
aatgagaaagagactcctagtgtggtgtacgtgacaccaatattatttttattgatcgaggcaaaaatgcaaaagaaaaaaagcaactaactaacaccac |
32412890 |
T |
 |
| Q |
110 |
ataatgatgccagaggcatttgccaaaacgaggcttgagctatttgaggtggagcagtcagcagtttaccatatctttatagatccacaattcatgctag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
32412889 |
ataatgatgccagaggcatttgccaaaacgaggcttgagctatttgaggtggagcagtcagcagtgtaccatatctttatacatccacaattcatgctag |
32412790 |
T |
 |
| Q |
210 |
caccaaactttgccaatcaatcaccacccaaaggatgagtgaaagaggttggttgaccaagag------atacacatttgaacttgatcaaaagcaatgg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32412789 |
caccaaactttgccaatcaatcaccacccaaaggatgaatgaatgaggttggttgaccaagagatactcatacacatttgaacttgatcaaaagcaatgg |
32412690 |
T |
 |
| Q |
304 |
cataag |
309 |
Q |
| |
|
|||||| |
|
|
| T |
32412689 |
cataag |
32412684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University