View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21182_high_14 (Length: 305)
Name: NF21182_high_14
Description: NF21182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21182_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 20 - 146
Target Start/End: Complemental strand, 14539092 - 14538966
Alignment:
| Q |
20 |
caccacagacgaccatgattctgtttgtcacagtagaccaccggcaagattctcactcacttgtataaatgttactttgtgtgtatgattatgaatgttc |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
14539092 |
caccatagacgaccatgattctgtttgtcacagtagaccaccggtaagattctcactcacttgtataaatggtactttgtgtgtatgattatgaatgatc |
14538993 |
T |
 |
| Q |
120 |
atcgattggttttatatataaagtgat |
146 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
14538992 |
attgattggttttatatataaagtgat |
14538966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 169 - 275
Target Start/End: Complemental strand, 14538903 - 14538797
Alignment:
| Q |
169 |
tatattttgtataaatctctatgcaccaagagtataaatcttactatgttttgtgttaatttgtaaaaagattttacaatatatatgcctaaattcagag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14538903 |
tatattttgtataaatctctatgcaccaacgctataaatcttactatgtattgtgttaatttttaaaaagattttacaatatatatgcctaaattcagag |
14538804 |
T |
 |
| Q |
269 |
gaggtgt |
275 |
Q |
| |
|
||||||| |
|
|
| T |
14538803 |
gaggtgt |
14538797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University