View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21182_low_2 (Length: 229)
Name: NF21182_low_2
Description: NF21182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21182_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 43907584 - 43907789
Alignment:
| Q |
1 |
ttgttccgaaacattgtctatgcatcaatcgccgcaagtttctgacttcgaaaataaagagatgggagcgtttcaagaaaactttcaatcaagaaatgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43907584 |
ttgttccgaaacattgtctatgcatcaatcgccgcaagtttctgacttcgaaaataaagaggtgggagcgtttcaagaaaactttcaatcaagaaatgtt |
43907683 |
T |
|
| Q |
101 |
gttgattctgttccaaattatgttgaatttgaaagcagccccacctcttccatgatcaacctgaacctatataaaagtaacagacaccataacggtattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43907684 |
gttgattctgttccaaattatgttgaatttgaaagcagccccacctcttccatgatcaacctgaacctatataaaagtaacagacaccataacggtattt |
43907783 |
T |
|
| Q |
201 |
cacacc |
206 |
Q |
| |
|
|||||| |
|
|
| T |
43907784 |
cacacc |
43907789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University