View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21183_high_11 (Length: 292)
Name: NF21183_high_11
Description: NF21183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21183_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 10 - 239
Target Start/End: Original strand, 30305206 - 30305435
Alignment:
| Q |
10 |
attattctcctacaatgtctctccttaatcatagaagtatggtctcatccaatattttttctttatgtttggatgcttcgataattgttcattaatatta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30305206 |
attattctcctacaatgtctctccttaatcatagaagtatggtctcatccaatattttttctttatgtttggatgcttcgataattgttcattaatatta |
30305305 |
T |
 |
| Q |
110 |
tgagagcttgtaacttctctcaatatagtacatgtgttatttggttttggttcatttaacttatttgattgcgtataaattactctttgaccgaacgaca |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30305306 |
tgagagcttgtaacttctcttaatatagtacatgtgttatttggttttggttcatttaacttatttgattgcgtataaattactctttgaccgaaagaca |
30305405 |
T |
 |
| Q |
210 |
tcattaacaatagtaattgatccttcaatt |
239 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
30305406 |
tcattaacagtagtaattgatccttcaatt |
30305435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University