View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21183_low_7 (Length: 441)
Name: NF21183_low_7
Description: NF21183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21183_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 6e-75; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 12 - 192
Target Start/End: Original strand, 384776 - 384959
Alignment:
| Q |
12 |
aacctgtgtatgactgagttatgcaagtcagtgagagtgtaaatgtcaaaataatgtggcaaccgtctcaacaagggtatggctaattgagtagtat--- |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
384776 |
aacctgtgtatgactgagttatgcaagtcagtgagagtgtaaatgtcaaaataatgtggcaaccgtctcaacaagggtatggctaattgagta-tatctc |
384874 |
T |
|
| Q |
109 |
ctcctgtcttacat-aaccaatgtttaggatataataactatcactgttcaactgaaagccctttaatgtgatgtaatggtaaaa |
192 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
384875 |
ctcctgtcttacataaaccaatgattaggatataataactatcactgttcaagtgaaagccctttaatgtgatgtaattgtaaaa |
384959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 285 - 383
Target Start/End: Original strand, 385439 - 385537
Alignment:
| Q |
285 |
gtcaacgaaaagggttttcaaaattacgcttataaccctctcagtgccaccatgtttttcaaacaaaaataattaccgaggcattctattctgtatagt |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
385439 |
gtcaacgaaaagggttttcaaaattacgcttataaccctctcagtgccaccaggtttttcaaacaaaaataattacctaggcattctattctgtatagt |
385537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University